Help for using HDOCK server


1. How to provide input for docked molecules

The HDOCK server is to predict the binding complexes between two molecules like proteins and nucleic acids by using a hybrid docking strategy. Therefore, users need to provide input for the two molecule to be docked. The HDOCK server can accept four types of input for molecules:

Only ONE type of input is needed for each molecule.

If more than one types of input are provided, the first one will be used. For the "PDB ID:ChainID" input, the user can provide one single chain ID or multiple chain IDs. For example, "1CGI:E" stands for the chain E of the pdb file of 1CGI; "1AHW:AB" stands for the chains A and B of the pdb file of 1AHW. If only a sequence is provided, the server will automatically constuct a model structure from a homologous template in the Protein Data Bank using a in-house modeling pipeline of HH Suite , Clustaw2, and MODELLER. In addition, users are also recommended to submit their own pdb file if the protein contains multiple chains, as our pipeline is currently designed to model single-chain proteins.

Molecular Type:
"Select a type" is not needed for structure input, as the HDOCK server is able to guess a general type of protein or RNA/DNA according to the input structure. However, for sequence input, users are strongly recommended to select a molecular type, because the HDOCK server may not be able to correctly guess the molecular type based on the sequence only. Here are the definitions of different molecular types:

Type		Description
Protein		Standard protein molecule
RNA		General single-chain RNA molecule
DNA		General single-chain DNA molecule
DNA/duplex	Right Handed B-DNA duplex molecule
RNA/duplex	Right Handed A-RNA duplex molecule
DNA/strand	Single-stranded helical DNA molecule
RNA/strand	Single-stranded helical RNA molecule
where the maximum input sequence is 500 for 'DNA/duplex', 'RNA/duplex', 'DNA/strand', and 'RNA/strand'.

2. RNA/DNA 3D structure modeling

HDOCK server now accepts sequence inputs for RNA/DNA. Only a single sequence is needed, which can contain the sequence only like this
>example
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA
or both the sequence and its secondary structure like this
>example
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA
(((((((..((((.........))))((((.(((((...))))))))).(((((.......))))))))))))....
HDOCK will then build its 3D structure based on the single sequence, or model a 3D duplex structure by construting a complementary Watson-Crick paired second strand.

3. How to specify the binding site [optional]

The HDOCK performs global docking to predict the binding complexes between two molecules. Therefore, no information about the binding site is necessary for the docking job. However, the server also gives users the option to specify the binding site residues if such information is available, such that the predicted models will have a higher accuracy. Two types of binding site information can be provided.

4. SAXS experimental data curve

The small-angle X-ray scattering (SAXS) experimental data can be provided as a post-docking filter for ranking the binding modes predicted by the HDOCK docking. The SAXS data file contains three columns, q, I(q), and error, like this
        0.0000E+00  1.4612E+07  3.0685E+03
        1.0000E-03  1.4743E+07  4.8653E+03
        2.0000E-03  1.4827E+07  7.3394E+03
        3.0000E-03  1.4685E+07  1.0573E+04
        4.0000E-03  1.4674E+07  1.3206E+04
        5.0000E-03  1.4659E+07  1.5831E+04
        6.0000E-03  1.4729E+07  1.5466E+04
        7.0000E-03  1.4707E+07  1.7649E+04
        8.0000E-03  1.4594E+07  2.3642E+04
        9.0000E-03  1.4787E+07  2.8835E+04
With the SAXS experimental curve, the final solutions will be ranked according to their CHI values that measure the goodness of the predicted binding modes fitting to the SAXS experimental data.