Help for using HDOCK server

1. How to provide input for docked molecules

The HDOCK server is to predict the binding complexes between two molecules like proteins and nucleic acids by using a hybrid docking strategy. Therefore, users need to provide input for the two molecule to be docked. The HDOCK server can accept four types of input for molecules:

• Upload your pdb file in PDB format.
• Provide your pdb file in PDB ID:ChainID (e.g. 1CGI:E).
• Copy and paste your protein sequence in FASTA format.
• Upload your protein sequence file in FASTA format

Only ONE type of input is needed for each molecule.

If more than one types of input are provided, the first one will be used. For the "PDB ID:ChainID" input, the user can provide one single chain ID or multiple chain IDs. For example, "1CGI:E" stands for the chain E of the pdb file of 1CGI; "1AHW:AB" stands for the chains A and B of the pdb file of 1AHW. If only a sequence is provided, the server will automatically constuct a model structure from a homologous template in the Protein Data Bank using a in-house modeling pipeline of HH Suite , Clustaw2, and MODELLER. In addition, users are also recommended to submit their own pdb file if the protein contains multiple chains, as our pipeline is currently designed to model single-chain proteins.

2. RNA/DNA 3D structure modeling

HDOCK server now accepts sequence inputs for RNA/DNA. Only a single sequence is needed, which can contain the sequence only like this

>example
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA

or both the sequence and its secondary structure like this

>example
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA
(((((((..((((.........))))((((.(((((...))))))))).(((((.......))))))))))))....

HDOCK will then build its 3D structure based on the single sequence, or model a 3D duplex structure by construting a complementary Watson-Crick paired second strand.

3. How to specify the binding site [optional]

The HDOCK performs global docking to predict the binding complexes between two molecules. Therefore, no information about the binding site is necessary for the docking job. However, the server also gives users the option to specify the binding site residues if such information is available, such that the predicted models will have a higher accuracy. Two types of binding site information can be provided.

• Binding site resdiues on the receptor or ligand.
The binding site residues are provided like this in the text box

	195:A, 203-206:A, 108:B

which stand for residues 195, 203-206 of chain A, and 108 of chain B. Note that the residues in a line must be separated by comma.

The binding site residues may also be submitted as a file that will look like this

	195:A
	203-206:A
	108:B

The residues are put on different lines in the file.


• Distance restraints between interacting residues
The users may directly provied such information on one line in the text box like

	195:A 236:B 8, 215-218:A 306:B 6

where the distance of residue 195 of chain A on the receptor and residue 236 of chain B on the ligand will be within 8 A; The distance of residues 215-218 of chain A on the receptor and residue 306 of chain B on the ligand will be within 6 A. Likewise, the above distance restraints can also be provided as a file that looks like this

	195:A 236:B 8 
	215-218:A 306:B 6

4. SAXS experimental data curve

The small-angle X-ray scattering (SAXS) experimental data can be provided as a post-docking filter for ranking the binding modes predicted by the HDOCK docking. The SAXS data file contains three columns, q, I(q), and error, like this

        0.0000E+00  1.4612E+07  3.0685E+03
        1.0000E-03  1.4743E+07  4.8653E+03
        2.0000E-03  1.4827E+07  7.3394E+03
        3.0000E-03  1.4685E+07  1.0573E+04
        4.0000E-03  1.4674E+07  1.3206E+04
        5.0000E-03  1.4659E+07  1.5831E+04
        6.0000E-03  1.4729E+07  1.5466E+04
        7.0000E-03  1.4707E+07  1.7649E+04
        8.0000E-03  1.4594E+07  2.3642E+04
        9.0000E-03  1.4787E+07  2.8835E+04

With the SAXS experimental curve, the final solutions will be ranked according to their CHI values that measure the goodness of the predicted binding modes fitting to the SAXS experimental data.